Detection of an Alu Polymorphism

by Polymerase Chain Reaction

 

As illustrated below, this exercise has four distinct steps. Since all four steps cannot be completed in one three hour session, the different steps will be completed over the course of several weeks. When working on any given step, it is a good idea to be aware of the overall exercise.

 

Step one

extract

cheek cells                     Step 2

Isolate DNA                                   Step 3

Amplify (PCR) DNA region

that may or may not have pv-92                                    Step 4

electrophoresis to resolve

amplified regions, & analyze

 

 

 


Objectives

1. Reinforce concepts of exons, introns, and DNA synthesis

 

2. Gain an insight into what transposons are, and their number and significance in the human genome

 

3. Learn techniques important to and commonly used in biotechnology.

 

4. Each student is to determine the number of copies, if any, of a particular jumping gene he or she has.

 

Background Information

Each human chromosome is a very long double stranded DNA molecule, and contains millions of nucleotides (Aís, Tís, Gís and Cís). The pattern of these Aís, Tís, Gís and Cís form the complete human genome. It is currently estimated that the human genome has over 40,000 genes. While these genes code for the cellular activities that collectively result in a human being, a great part of human DNA, about 25%, belongs to a category called transposons.

 

Transposons, or jumping genes, have no apparent human related function, they appear to serve only to perpetuate themselves. There are a variety of different types of transposon (jump

 

ing genes) present in each human cell. The Alu family of transposons are only about 300 base pairs in length. When one is ìactivatedî, it makes a copy of itself, and this copy is inserted randomly into one of the 46 chromosomes. As might be expected, the number of transposons per cell increases each time one is copied. Over millions of years, the number of Alu type transposons has grown to the extent that each human cell has over 2,000,000 copies (one million per haploid set of chromosomes). With so many copies, the Alu type of transposons amounts to approximately 10% of human DNA.

 

Exactly where in a chromosome a transposable element inserts itself could be of great consequence. To see how, one needs to know that most of the 40,000 plus human genes code for proteins. Whether a protein is an enzyme, a transport molecule, or has some other function, each protein contributes to some aspect of cell life. Most genes have exons (coding regions) and introns (non-coding regions), Promoters (region wher RNA polymerase attaches, and regulatory elements influence whether or not and the extent to which a gene is transcribed. The Aís, Tís, Gís and Cís within exons code for the amino acids that make up the functional protein. Any change in the coding region (exon) of a gene could be disastrous because the change might result in the production of a protein that does not function normally. Severe human diseases, such as mental retardation, immunodeficiencies, and cancer, are caused by changes in the coding regions of certain genes. Neurofibromatosis, a tumor disease, is an example of a human disease caused by the insertion of an Alu transposon into the coding region of a gene, the NF1 gene. In contrast, insertions into introns (non-coding regions of a gene) generally have no effect on a geneís protein product.

 

Since there are so many transposons in every cell, and since insertions into exons can have serious consequences, it is often asked if transposons can have any benefits. One school of thought is that the many transposon copies increase the probability of molecular events where segments of DNA from different areas are exchanged. Because such exchanges can give rise to new genes and new gene combinations, is thought that transposons might be significant in evolution.

 

Alu-pv92 is the specific transposon that is the focus of this exercise. This insertion is found within an intron. Since the Alu-pv92 insertion occurs within an intron, the insertion has no effect on the production of this geneís protein. While the Alu-pv92 insertion is wide spread in human populations throughout the world, its frequency is greater in certain parts of the world (see the website listed in the next paragraph). Nonetheless, it is expected that several students in each laboratory section will have one or two copies.

 

The web site

http://vector.cshl.org/geneticorigins

is very good. It explains what Alu transposons are, how they make copies of themselves, and how the copy inserts itself elsewhere.

 

First open the web site.

Click on the PV-92 insertions icon

Click on Continue on to Alu Insertion Polymorphisms

Then read over the text giving Alu stats, number of Alu copies per cell, what per cent of the human genome Alu occupies, how long Alu elements are, and type of transposon Alu is an example of.

 

NEXT

Click on MEDIA/ANIMATION

Then click on ìHow Alu Jumpsî to see the jumping mechanism.

 

What evidence is there that Alu transposons are ìretrotransposons?î

 

The heart of this exercise is that you will use state-of-the-art biotechnology to determine how many, if any, copies of PV-92 you have.

    You will first isolate your own DNA from a sample of your cheek cells.

    You will then use PCR to make millions of copies of a targeted region (the region that may or may not have PV-92) of your genome.

    Finally, you will use electrophoresis to resolve the DNA you made millions of copies of.

You will then use a powerful data base to determine:

    What chromosome pv92 is located in

    The name of the gene housing the intron carrying pv92

    The name and function of the gene housing the intron

 

Polymerase Chain Reaction (PCR)

The web site mentioned above is also excellent for its PCR animations. This animation lets you see how PCR works, and helps reinforce the concepts of how DNA strands are held together, what primers are and do, and how DNA synthesis is accomplished.

 

Use the following address to go directly to the PCR animations

 

http://vector.cshl.org/geneticorigins/pv92/aluframeset.htm

 

Click on MEDIA/ANIMATION

Then click on Polymerase Chain Reaction

 

Answer the following based on the website introduction

 

What is a primer, and what do they do?

What two innovations are important to PCR?

 

Next press ìMenuî (lower left on the screen),

then click on ìAmplificationî

 

Try to answer the following questions as you proceed through the PCR animation. Be sure to ask your instructor if you can not figure out the answers.

 

What holds the DNA strands together?

 

 

Why is a high temperature required during denaturation?

 

What happens during the annealing step?

 

 

Why must the temperature be reduced during the annealing step?

 

What happens during the extend primers step?

 

Note that you can repeat a step many times. This is helpful to reinforce what is going on at a given step.

 

Press ìGo to Second Cycleî and continue until you see the results of the fifth cycle.

When finished with the PCR animation, Click on the Menu (lower left on the screen). Then Click on Amplification Graph. Keep clicking on Next Cycle until you have 25 cycles.

How many copies of the targeted region are there after 25 cycles?

 

Please visit this web site and answer all of the questions before you go lab to do Step three (PCR to amplify DNA region that may or may not have PV-92)

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

.


 


Two very important facts regarding PCR are


1. primers determine the beginning and end of a specific segment DNA to be amplified

 

 

2. the number of DNA segments doubles after each cycle (separating DNA strands, primer binding, and extending the primer)

 

 


 

 


Using PCR to detect the presence of PV-92

So how does PCR allow one to determine if they have one, two, or no copies of the pv-92 transposon? First recall that pv-92 is located in an intron of chromosome #16, and that everyone has two chromosome #16ís (one contributed from their mother, and the other one contributed from their father at the time of conception).

 

In the following example both chromosome #16ís of an individual is shown. In this case, the intron of one of the personës #16 chromosomes has the pv-92 transpo

 

 

 

 

son, and the intron of this personís other chromosome #16 does not have pv-92.

 

Arrows show where the primers used in PCR will bind. Primer one will determine the beginning, and primer two will determine the end of the intron region that PCR will make millions of copies of.

 

In this example case, PCR would make millions of copies that are 550 bases (does not have pv-92), and also millions of copies that are 850 bases (has pv-92). The next step would be to sort out and look at these two different sized pieces.

 




Determining PCR product size

It should be apparent from the two examples that the size of the amplified segment is used to determine the presence of the 300 base pv-92 transposon. If the amplified segment is 550 bases long, then it does not contain the transposon. However, if the amplified segment is 850 bases long, then the amplified segment contains the 300 base transposon. How then does one determine the size of the PCR product? The method used is called electrophoresis. First, DNA samples are loaded onto a gel, and electric current is applied. Because DNA is uniformly negatively charged, DNA is caused to migrate through the gel toward the positive electrode. Shorter molecules migrate faster then longer ones. Often DNA of known sizes (a ladder) is run in the same gel.


 

 

The following is an example of a gel run in a previous Bio 111 class. Samples were loaded in at the top.

A B C

100

 

1000

 

500

 

 

Discuss the following with others at your table.

 

Which sample B or C contained DNA segments that were shorter?

 

Noting the band of the ladder that is 500 bases, approximately how big is the DNA of sample C?

 

How can you explain the two DNA bands of sample A?

 

Which band A, B, or C is homozygous without the transposon? Explain

 

Which band A, B, or C is homozygous with the transposon? Explain

 

Which band A, B, or C is heterozygous with transposon? Explain

 

Laboratory Procedure


As illustrated below, this exercise has four distinct steps. Since all four steps cannot be completed in one three hour session, the different steps will be completed over the course of several weeks. When working on any given step, it is a good idea to be aware of the overall exercise.


 

 

Step one

Step one

extract

cheek cells Step two

Isolate DNA                                Step three

Amplify (PCR) DNA region

that may or may not have pv-92                                  Step four

electrophoresis to resolve

amplified regions, & analyze

 

 

 


Cheek Cell Extraction

Do not consume food or drink for at least 30 minutes prior to cheek cell extraction.

 

1. With a sterile cotton swab, gently scrape the inside of one cheek six times. Without rotating the swab, move the swab directly over to the inside of the other cheek and gently scrape six times.

 

2. Gently touch part of the swab containing your cheek cells on a clean glass slide once. Add a drop of methylene blue, then a cover slip. Examine using the high dry objective.

 

3. Insert the cotton portion of the swab into the mouth of a 1.5 ml microcentrifuge tube. The, using scissors or a pair of dikes, cut off the stick just above the cotton so that the cotton part falls into the tube. Close the lid, use a water insoluble ink to label your tube, and place the tube into the rack provided by your instructor. Your instructor will then place the tubes in the freezer (-20o) for storage.

 

4. Make a drawing of your cheek cells in the box provided below, be sure to

indicate the magnification.


 

 

 

 

 

 

 

 

 

 

 

 

 

 



Step two

Step one

extract

cheek cells           Step two

Isolate DNA             Step three

Amplify (PCR) DNA region

that may or may not have pv-92                                  Step four

electrophoresis to resolve

amplified regions, & analyze

 

 


DNA Isolation

1. Add 400 ml of phosphate buffered saline (PBS) to the tube containing the cotton swab coated with your cheek cells.

 

2. Add 400 ml of Qiagen buffer AL. This contains a detergent to aid in cell disruption, and to solubilize hydrophobic compounds.

 

3. Add 20 ml of protease K solution. Close the lid and vortex immediately for 15 seconds. Immediate mixing is required to maximize cell lysis. This enzyme digests proteins, which will aid cells lysis, and in isolating the DNA.

 

4. Place your microcentrifuge tube in a heat block set to 56o, and incubate for ten minutes. Remove the tube and tap the tube on the counter to cause droplets, that may have condensed on the inside of the lid, to fall into the solution below.

 

5. Add 400 ml of pure ethanol (190 ñ200 proof). Vortex for 15 seconds. This amount of ethanol will cause the DNA to precipitate but will leave the other compounds (proteins, carbohydrates, lipids, and salts) to remain in solution.

 

6. Remove 700 ml and place into a QIAamp spin column that is seated in a 2 ml microfuge tube. Centrifuge at 8000 RPM for one minute. At this point the precipitated DNA is retained by the filter in the spin column, and the soluble compounds have been forced to the tube below.

 

Discard the tube containing the filtrate, and insert the spin column containing your DNA into a new 2 ml microfuge tube.

 

7. Add 500 ml Quiagen buffer AW1 without wetting the rim of the spin column. Centrifuge at 8,000 RPM for one minute. This, and the next step serve to wash the DNA. Since these wash solutions contain ethanol, the DNA remains precipitated and unable to pass through the filter in the spin column. Discard the tube containing the filtrate, and insert the spin column into a new 2 ml microfuge tube.

 

8. Add 500 ml of Qiagen buffer AW2 without wetting the spin column rim. Centrifuge at 14,000 for 3 minutes. Complete removal of the AW2 buffer is necessary as its presence would prevent subsequent resolubilization of the DNA trapped in the spin column. Therefore, carefully remove the 2 ml microfuge tube to avoid splashing the filtrate back on to the spin column. Discard the microfuge tube containing the filtrate.

 

9. Insert the spin column into a sterile 1.5 ml microfuge tube. Add 150 ml of AE buffer. This buffer has no ethanol and will bring the precipitated DNA back into solution. Incubate at room temperature for one full minute to give the DNA time to dissolve in the buffer.

 

10. Centrifuge at 8,000 RPM for one minute. The collection tube now contains your isolated DNA in solution. Label the tube with a water insoluble marker, and place it in the rack provided by your instructor. You instructor will store the

tubes at ñ20oC.



Step three

Step one

extract

cheek cells                   Step two

Isolate DNA                                  Step three

Amplify (PCR) DNA region

that may or may not have pv-92  Step four

electrophoresis to resolve

amplified regions, & analyze

 

 

 


 

Polymerase Chain Reaction (PCR)

1. Obtain a PCR reaction tube containing a PCR reaction bead

 

2. Add the following

q      10ml of your own isolated DNA

and

q      15 ml of the primer/loading dye mixture

 

3. Close the PCR reaction tube lid, and mix the contents. Gently tap the tube on the counter to cause all the liquid to go to the bottom of the tube

 

4. Place you reaction tube into the thermocycler, and record its location.

 

Location _______________

 

5. After your instructor starts the 9700 thermocycler, observe one complete cycle. Be thinking about what is occurring at each of the steps in a given cycle. Then, record the temperature for the following:

 

Denaturation _______

Annealing _________

Extension_________

 

 

 

How many cycles is the machine programmed for?________

 

Once the reaction has started, observe the PCR animation on the computer hooked up to the web!

 

 

Once the program has run its course, your instructor will remove the tray containing all the reaction tubes, and will store them in the in the freezer.

 

 

 

 

Considering that each cell has billions of nucleotides arrayed on 46 chromosomes, how many places will the primers, shown below anneal to?

 

 

 

 

 

 

 

 

Notes:

The PCR reaction beads contain

       Taq polymerase, a temperature resistant DNA polymerase,

       Mg ions needed by the enzyme,

       buffer to maintain the correct pH, and

       A, T, G, and C nucleotides.

 

The primer mixture contains two primers, one for the beginning and one for the end of the region to be amplified. The sequences

of these two primers are


 

5í AACTGGGAAAATTTGAAGAGAAAGT, and 5í CTCAAGAAACAGAAGCCCTGTCACC

Step four

 

Step one

extract

cheek cells                   Step two

Isolate DNA                                Step three

Amplify (PCR) DNA region

that may or may not have pv-92                                   Step four

electrophoresis to resolve

amplified regions, & analyze

 

 

Electrophoresis to resolve amplified regions and analysis


Work in groups of 6

 

1. Following instructions given by your instructor, prepare a two percent agarose gel as follows:

o      weigh out 0.40 grams of agarose

o      add to a 50 ml flask containing 20 ml of TAE buffer

o      microwave on high for 30 seconds

o      use tongs, as the flask is now very hot, and swirl the contents to insure all of the agarose is dissolved

o      allow solution to cool before pouring into the gel casting tray.

 

2. When the gel is solidified, takes about 10 minutes, pour TAE buffer into the reservoirs until there is about one millimeter of buffer above the gel

 

3. At least one well per gel is to have a 100 bp ladder. One person of the group should load 5 ml of the ladder (already contains a loading buffer) into the center well.

 

 

 

 

4. Each student of the group is to load 10 ml of their own PCR product into a well. Since the PCR reaction mix already contains a loading buffer, there is no need to add additional loading buffer to it.

 

 

5. Secure the gel tank cover in place, attach electrical cables, set the power supply to 85 volts (this gives a field strength of 5 volts per centimeter), and press the start button.

 

6. When the loading buffer dye is between half and three quarters across the gel, turn off the power supply.

 

7. Wearing eye protection and gloves, lift the tray containing the gel out of the gel tank, and carry it to where the ethidium

bromide containers are located

 

 

.


.


 

 

ETHIDUIM BROMIDE IS A CARCINOGEN

Gloves and full eye protection

must be used whenever working close to ethidium bromide

 

 


8. Hold the tray close to the ethidium bromide solution. Using one finger, protected by gloves, gently push the gel into the ethidium bromide solution. Let sit for about 10 minutes. During this time, ethidium bromide binds to DNA.

9. Use a spatula to transfer the gel from the ethidium bromide solution to water. Let sit an additional 10 minutes. During this time unbound ethidium bromide diffuses into the water. This will result in a cleaner, sharper picture.

 

10. Still wearing gloves and eye protection, pour out the water from the rinse tray, and carry the tray containing the gel over to the Gel Doc 2000. Use a spatula to transfer the gel on to the trans-illuminator of the Gel Doc 2000. Your instructor will point out the orange fluorescence of ethidium bromide bound to DNA, will capture the image, and will print out one copy for each student. Paste the picture of this gel next to the gel shown below.

 

11. Use the 100 bp ladder to determine the size of each DNA band. From the results determine your genotype with respect to the Alu-pv92 insert.


 

 



Where is pv 92?

As stated earlier in this exercise, pv 92 resides in an intron. However, a question students ask is ìwhat is the name of the gene that houses the intron that pv 92 resides in?î This part of the exercise, actually an outside of class assignment, is to answer this question using state-of-the-art tools currently used in industry.

 

Each chromosome is essentially a very long DNA molecule that contains the bases A, T, G, and C bonded together in a very long chain. Importantly the human genome has been sequenced, that is from the tip to the end of each chromosome researchers have determined the actual sequence of As, Ts, Gs, and Cs. It has been found that each region of the chromosome, each gene, has its own unique sequence of As, Ts, Gs, and Cs. So, if one knew the sequence of a region like an intron, one could simply scan the entire DNA sequence to locate precisely where on which chromosome this sequence is located. This is exactly what you will do. However, there is one problem. You need the sequence of the intron pv 92 resides in. Recently several Cal Poly undergraduate students did this, and the sequence is posted on a web site. So how do you find where on chromosome 16 this sequence is located? You will use a data base that contains the human genome. The following will lead you through the steps.

 

Your assignment is to determine the name and function of the gene housing the pv92 It takes just a few minutes. How? There is an online database containing the human genome, and recently a couple of undergraduate students in our department sequenced 500 bases of the "particular intron." Find a computer with internet access.


 

 

1. First, obtain the intron sequence by visiting www.bio.calpoly.edu/ubl.

 

2. Click on "protocols", then on "Alu sequence." Copy the entire sequence.

 

3. Next visit the database www.ncbi.nih.gov.

 

4. Click on "BLAST" in the toolbar above the search box.

5. Then, Click on "Human" under Genomes. See below.

 

 

 

 

 

 

 

 

 

 

 


6. Paste the intron sequence you obtained from UBL into the search box.

 

 
 

 

 

 

 


7. Hit BEGIN SEARCH.

 

The database compares your submitted sequence to all others in the database, and records matching sequences!

 

An estimated time is given.

 

8. Hit FORMAT! to see the results.

 

 

9. Hit "Genome View"

 

What comes up next is really cool! Inspect each of the chromosomes shown for a red tick. What chromosome number is it?

 

10. Click on the chromosome number.

 

This brings you to part of a map showing the exact location of the "particular intron", AND, it gives you the name of the gene.

 

11. Click on the name of the gene (which is CDH13). This brings you to a page giving you the name of the gene, a summary of its functions, and kinds of problems that can come about if the gene malfunctions.

 

 

Powerful stuff!


Review Questions:

1. Indicate the genotype of each lane in the gel below. Also indicate which bands have the Alu-pv92 insert, and which bands do not contain the Alu-pv92 insert.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

2. What is lane 6 of the above gel, and how is it used?

 

3. See the questions on page 73

 

4. What is a primer, and how is a primer used in PCR?

 

5. Starting with a gene, make an annotated flow diagram that illustrates transcription, intron removal, protein synthesis, and finally function of the protein coded for by the gene.

 

6. What are the three steps in a PCR cycle, and what do each do?

 

7. Compared to the amount of DNA at the beginning of one PCR cycle, how much DNA is present at the end of that cycle? How many copies of the DNA region targeted by the primers present after 30 cycles? (see the web site http://vector.cshl.org/geneticorigins)

 

8. What is an exon, intron, and promoter?

 

9. Describe the possible effects on the production of a functional gene product (protein) if a transposon was inserted into an exon, intron, or promoter of a gene.

 

10. What does gel electrophoresis do, and how is this accomplished?

 

11. Why is it necessary for DNA strands to separate during DNA replication?

Compare how the separation of DNA strands occurs during DNA replication in a human cell with how DNA strands are separated in PCR.

 

12. What does Taq polymerase do in PCR? What is the source of Taq polymerase? Compare the properties of Taq polymerase with human DNA polymerase.

 

13. The following questions relate to DNA isolation: What was accomplished when cheek cells were incubated with detergents and proteinase K? Why was ethanol added? What purpose did the filter in the spin column serve?

 

14. If your mother were homozygous with pv-92 and your father was homozygous without, then what pattern on the gel you expect from your DNA? Explain